PB PrimerBac

Ureaplasma urealyticum

Phylum:Tenericutes Class:Mollicutes Order:Mycoplasmatales Family:Mycoplasmataceae Genus:Ureaplasma Species:Ureaplasma urealyticum
On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.
Primer Species LP RP Tml Tmr Length Score ⇅ On-target ⇅ RI genome sensitivity ⇅
Primer 1 Ureaplasma urealyticum TCCATATCTTGTCGTTGGCGA TCGTGACGTACAAAAGCATCA 59.52 58.25 192 31
100.00%
100.00%

Showing 1 to 1   (all 1 pages)